This study was performed in a cohort of adult SCD patients seen at the Outpatient Clinic of the Hematology and Hemotherapy Center, Universidade Estadual de Campinas (UNICAMP). Patients that were homozygous for Hb S (Hb SS), heterozygous with Hb C and S (Hb SC), and heterozygous with β-thalassemia and S (Hb Sβ) were included. All of the patients were in steady state therefore none had had painful crises, hospitalizations or blood transfusions during the three months preceding blood sample collection. A group of 188 age-matched healthy subjects (Hb AA) were analyzed as controls for telomere length measurement.10 An additional 70 age- and gender-matched healthy subjects (Hb AA) were evaluated for lymphocyte counts and interleukin-8 (IL-8) levels. Venous blood samples for all study analyses, including peripheral blood counts and hemolysis markers, were obtained during clinic visits. The University's Ethics Committee approved the study and all patients gave their written informed consent.

Genomic DNA was extracted from the buffy coat of healthy controls’ peripheral blood leukocytes up to 48h after collection, using the Gentra Purege Blood Kit (Qiagen, Maryland, USA). DNA samples were quantified, diluted to 50ng/μL and stored at −20°C. Genomic DNA from SCD patients was isolated from frozen white blood cells (WBC). Briefly, whole peripheral blood samples were washed in phosphate buffered saline (PBS) with 0.1% bovine serum albumin (BSA) up to 16h after collection and incubated on ice cold ammonia chloride (NH4Cl) for osmotic red blood cell lyses. WBCs were counted, aliquoted, and frozen at −80°C in 10% dimethyl sulfoxide (DMSO) until defrosting and DNA extraction, performed using the Gentra Purege Blood Kit (Qiagen, Maryland, USA). Genomic DNA (50ng/μL) was checked for integrity in 0.8% agarose gel at 80V for 40min. For quantitative polymerase chain reaction (qPCR), DNA dilutions of 5ng/μL were prepared and kept at 4°C up to seven days, when the subsequent dilutions of 0.2ng/μL were used for every run prepared just before experiments.

The mean leukocyte telomere length was determined by qPCR as has been described previously.11–13 All qPCR reactions were prepared on a QIAgility automated pipettor (Qiagen, California, USA), amplification was conducted in triplicate in the Rotor-Gene Q 5plex HRM Instrument (Qiagen), and analysis was completed using Rotor-Gene Q Software Version 2.2.3. The 24μL final volume reactions included: 8μL of genomic DNA (0.2ng/μL), 2× Rotor-Gene SYBR Green PCR kit (Qiagen, Hilden, Germany), RNase-free water (Qiagen), and the primers Telomere Fw (CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT – 300nM) and Rv (GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT – 300nM) or single gene (36B4) Fw (CAGCAAGTGGGAAGGTGTAATCC – 300nM) and Rv (CCCATTCTATCATCAACGGGTACAA – 500nM). Telomere reactions were performed as follows: denaturation at 95°C for 5min followed by 25 cycles of 7s at 98°C and 10s at 60°C, whereas single gene reactions were denatured at 95°C for 5min followed by 35 cycles of 7s at 98°C and 10s at 58°C. The telomere length for each sample was determined using the telomere to single copy gene ratio (T/S ratio) with the calculation of ΔCt [Ct(telomere)/Ct(single gene)]. The T/S ratio for each sample (x) was normalized to the mean T/S ratio of the reference sample [2−(ΔCtx−ΔCtr)=2−ΔΔCt], which was used for the standard curve, both as a reference sample and as a validation sample. The acceptable coefficient of variations (CV) of triplicate measurements were 2% and 1% or less, for telomere and single gene reactions, respectively. The considered inter-assay CV was up to 5%.

To validate the qPCR terminal restriction fragment (TRF), analysis was performed by Southern blot of 17 samples according to the manufacturer's instructions with minor changes (TeloTAGGG Telomere Length Assay – Roche Applied Science, Mannheim, Germany). Briefly, 800ng of genomic DNA was digested by an optimized mixture of HinfI and RsaI FastDigest restriction enzymes (Thermo Scientific, Waltham, MA, USA) at 37°C for 2h. Following DNA digestion, DNA fragments were separated by electrophoresis in 0.8% agarose gel during four hours at 80V. Gel was denatured and neutralized, samples were transferred to a nylon membrane by Southern blotting and probed, and the terminal restriction fragments were detected by chemiluminescence. Mean TRF length was determined according to the formula TRF=Σ(ODi)/Σ(ODi/Li), where ODi is the chemiluminescent signal and Li is the length of the fragment at a given position.

Tumor necrosis factor-alpha (TNF-α) and IL-8 were assessed as pro-inflammatory markers. TNF-α and IL-8 levels were measured, in duplicate, in serum samples using ultra-sensitive enzyme-linked immunosorbent assay (ELISA) kits according to the manufacturer's instructions (TNF-α US and IL-8 US, Invitrogen, Camarillo, CA, USA).

The relationship between telomere length and age was estimated using linear regression. Estimated regression coefficients were used to calculate the observed minus expected (O-E), or age-adjusted telomere length for each subject. Age-adjusted T/S ratios were used for all the study analyses except for the correlation with age. Spearman's rank correlation coefficient was used to analyze bivariate associations between telomere lengths, hemolysis and inflammation markers. T/S ratios were compared according to the diagnosis, use of hydroxyurea and gender using Wilcoxon rank sum test. Linear regression was used to analyze the correlation between telomere length measured by qPCR and TRF by Southern blot. All p-values ≤0.5 were considered significant. Statistical analyses were performed using the R statistics program version 3.1.3.

Ninety-one adult SCD patients were included in the study: 51 Hb SS, 38 Hb SC, and 2 Hb Sβ+. Forty were on hydroxyurea with a median dose of 1g/day (range: 500–1750mg/day). The dose was titrated according to clinical improvement or to the maximum tolerated dose. The clinical indications for hydroxyurea were frequent painful crises (n=14; 35%), acute chest syndrome (n=5; 13%), stroke (n=6; 16%), and severe hemolytic anemia (n=15; 37%). Patients’ clinical characteristics are described in Table 1. The control group consisted of 188 healthy individuals (Hb AA), with a mean age of 38 years (range: 18–88 years), including 97 women and 91 men.

Telomeres were significantly shorter in SCD patients compared to age-matched healthy controls [T/S ratio: −0.28 in SCD vs. −0.01 in controls; standard deviation (SD)=0.20 vs. 0.23; p-value<0.0001 – Figure 1A]. When genotypes were compared, the telomeres were significantly shorter in Hb SS patients than in the Hb SC and Hb Sβ genotypes (T/S ratio: −0.34 vs. −0.21, respectively; SD=0.17 vs. 0.21; p-value<0.0001 – Figure 1B). Telomeres were also shorter in patients on hydroxyurea (T/S ratio: −0.34 vs. −0.25; SD=0.20 vs. 0.20; p-value=0.02) (Figure 1C). Although telomeres shortened with age in healthy controls (r=−0.5; p-value<0.0001), age did not affect telomere length in SCD patients (r=−0.02; p-value=0.8). Telomere length was not influenced by gender in either SCD patients (p-value=0.2) or controls (p-value=0.9).

Figure 1.

Age-adjusted T/S ratio in controls and sickle cell disease (SCD) patients. (A) SCD patients presented shortened telomere length compared to normal controls. (B) Hb SS patients presented shortened telomere length compared to Hb SC and Hb Sβ patients. (C) Hb SS and Hb SC patients treated with hydroxyurea (Hb SS/Hb SC HU) presented shortened telomere lengths when compared to patients not treated with hydroxyurea (Hb SS/Hb SC/Hb Sβ+). T/S ratios were compared according to the diagnosis and use of hydroxyurea using Wilcoxon rank sum test. Mean telomere length was measured in peripheral blood leukocytes by quantitative polymerase chain reaction (qPCR).

(0,11MB).

In order to validate these findings, telomere lengths were also measured by Southern blot for 17 patients showing that T/S ratios and TRFs were highly correlated (R2=0.86; p-value<0.0001 – Figure 2) supporting the accuracy of the qPCR results.

Figure 2.

Correlation between telomere length measured by quantitative polymerase chain reaction (qPCR) and terminal restriction fragment (TRF) by Southern Blot. Analysis of 17 samples was performed to validate qPCR TRF. Telomere lengths measured by qPCR presented an adequate correlation with measurements of TRF by Southern blot, analyzed by linear regression (R2=0.86; p-value<0.0001).

(0,05MB).

The association between telomere length and marker levels for hemolysis (hemoglobin, hematocrit, lactate dehydrogenase, indirect bilirubin, reticulocyte counts) and inflammation (IL-8, TNF-α, total leukocyte, neutrophil, lymphocyte and monocyte counts) were analyzed (Table 2). There was a weak positive correlation between telomere length and hemoglobin concentration (r=0.3; p-value=0.004), but no correlation with other hemolysis markers. Among inflammatory markers, there was a weak negative correlation of telomere length with lymphocyte counts (r=−0.3; p-value=0.005) and with IL-8 serum levels (r=−0.4; p-value=0.02; Table 2). Of note, overall, SCD patients had higher lymphocyte counts (SCD: 2.9×109/L vs. controls: 1.9×109/L; SD=1.4 vs. 0.51; p-value<0.0001) and IL-8 levels compared to controls (SCD: 3.3pg/mL vs. controls: 2.3pg/mL; SD=1.9 vs. 0.8; p-value=0.009). Telomere length was not associated with the plasma levels of other inflammatory markers.