Journal Information
Vol. 40. Num. 4.October - December 2018
Pages 293-392
Share
Share
Download PDF
More article options
Visits
493
Vol. 40. Num. 4.October - December 2018
Pages 293-392
Case Report
DOI: 10.1016/j.htct.2018.02.007
Open Access
Rh Ew antigen in a multi-transfused patient with sickle cell disease
Visits
493
Vitor Mendonça Alvesa, Paulo Roberto Juliano Martinsa,b, Fernanda Bernadelli De Vitoa, Lilian Castilhoc, Helio Moraes-Souzaa,b,
Corresponding author
helio.moraes@uftm.edu.br

Corresponding author at: Hemocentro Regional de Uberaba/Fundação Hemominas, Avenida Getúlio Guaritá, 250, Abadia, 38025-440 Uberaba, MG, Brazil.
a Universidade Federal do Triângulo Mineiro (UFTM), Uberaba, MG, Brazil
b Hemocentro Regional de Uberaba, Fundação HEMOMINAS, Uberaba, MG, Brazil
c Hemocentro da Universidade Estadual de Campinas (UNICAMP), Campinas, SP, Brazil
This item has received
493
Visits

Under a Creative Commons license
Article information
Full Text
Bibliography
Download PDF
Statistics
Figures (1)
Tables (2)
Table 1. Primer sequences used in polymerase chain reaction-restriction fragment length polymorphism for RHCE*E/e genotyping.
Table 2. Sequences and annealing temperature of the primers used in the sequencing of the RHCE gene.
Show moreShow less
Full Text
Introduction

The Rh blood system is the second in clinical importance in transfusions and gestations1; however, it is the most complex with more than 50 antigens already having been described.2 Of the antigens, D, C, c, E and e, whose alloantibodies react at 37°C and cause hemolysis, are responsible by the vast majority of intercurrences in transfusions and gestations.3 The E antigen is expressed by the RHCE gene and differs from the e antigen by a single nucleotide polymorphism (SNP) (676C>G; Pro226Ala).4

The Ew antigen, a rare variant of the E antigen, was described for the first time in 1955.5 According to some reports in the literature, it is only found in Caucasians with a frequency of less than 0.1%.5–9 A hemolytic disease of the newborn (HDN) caused by anti-Ew maternal antibodies was reported in two of these reports5,7; in another, an anti-E alloantibody was found in an Ew positive patient, after receiving E positive red blood cells (RBCs).6 Although the antigen has been described only in Caucasians (and at a very low frequency), in this study, we found the phenotype with a molecular basis in a patient of mixed ethnicity (neither White nor Black) and sickle cell disease (SCD), highlighting the high level of miscegenation in Brazil.

Case report

We report on the case of a 30-year-old male patient with A RhD+ blood type and SCD and a history of more than 100 packed RBC transfusions at the Hemocentro Regional de Uberaba/Fundação Hemominas. He was of mixed ethnicity (White and Black) as were his ancestors (parents and grandparents). In 2009, his results of RBC alloantibody screening were positive; however, the antibody (present as a low titer) was not identified. In the same year, his erythrocyte phenotyping was performed by the Immunohematology Center of the Fundação Hemominas (Belo Horizonte, Brazil) and defined as Rh [C-c+ (Cw−); E+ (weak positive) e+]; K−; Fy (a+b+); Jk (a+b+); S-s+.

In 2014, after he gave his consent, a new blood sample was collected, with the RBCs submitted to a repeat phenotyping test using the gel centrifugation technique and the ID-DiaClon Rh-Subgroups+K card (Diamed-BioRad Latin America, Lagoa Santa, Minas Gerais, Brazil), with monoclonal antibodies,8 while the leucocytes had the DNA extracted using the Flexigene kit (Qiagen, Hilden, Germany). In both tests, the manufacture's recommendations were followed. The DNA was submitted to RBC genotyping by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP)10 and BeadChip wRHCE2.1 (Bioarray Solutions, Immucor, Warren, NJ, USA), also following the manufacture's recommendations.

PCR was performed with 50–100ng of DNA, 0.25μM of each primer, 0.25mM of each dNTP, 2.5mM of MgCl2, 1.0U Taq DNA polymerase and buffer 1×. PCR amplification was performed in a Veriti™ 96-well Thermal Cycler (Applied Biosystems, Foster City, CA, USA). The following conditions were used: denaturation at 95°C for 15min, followed by 35 cycles at 95°C for 30s, 62°C for 30s and 72°C for 40s, and a final extension step of 72°C for 10min. Amplified products were analyzed by electrophoresis in 1.5% agarose gel in Tris-Borate EDTA buffer (TBE). For enzyme digestion, the PCR product was incubated with Mnl I restriction enzyme overnight at 37°C according to the manufacture's recommendation. All reagents used in the PCR reactions were obtained from Applied Biosystems, Foster City, CA, USA. The RFLP analysis was performed after electrophoresis in 3.5% agarose gel in TBE. Primer sequences used in the PCR are described in Table 1.

Table 1.

Primer sequences used in polymerase chain reaction-restriction fragment length polymorphism for RHCE*E/e genotyping.

Primer  Primer sequence (5′→3′) 
CEI4 (sense)  GGCAACAGAGCAAGAGTCCA 
CEX5 (antisense)  CTGATCTTCCTTTGGGGGTG 

As one result of phenotyping (Rh(E-e+)) and genotyping (RHCE*E/RHCE*e) was discrepant, and he had not received transfusions of red blood cells in the 12 months preceding the last blood collection, his DNA sample was submitted to a sequencing of the RHCE gene, in order to identify the cause of the discrepancy.

All 10 exons of RHCE were sequenced. Amplification was performed with RHCE-specific primers designed to target flanking intronic regions (7) and sequencing analysis was performed in a 3500xL Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). Primer sequences and annealing temperature used are described in Table 2.

Table 2.

Sequences and annealing temperature of the primers used in the sequencing of the RHCE gene.

Exon  Primer sequence (5′→3′)  Annealing temperature 
1 (S)  catagacaggccagcacag  55°C 
1 (AS)  cctgctatctgctcctgtga   
2 (S)  ctcgtccttctcgccatct  55°C 
2 (AS)  ggattccttgtgatacacggagta   
3 (S)  atcctggctctccttctca  55°C 
3 (AS)  caagtgatcttccctcctcaa   
4 (S)  tgaactttctccaaggaccat  55°C 
4 (AS)  aatttagcaaacactactcaaagaag   
5 (S)  tggagcaggagtgtgattct  55°C 
5 (AS)  gtgaccacccagcattctt   
6 (S)  agaggtggtttcaggatcag  55°C 
6 (AS)  agccaaagcagagagcatta   
7 (S)  ccattgatgtgagtacacatt  50°C 
7 (AS)  gtaggggctggacataatt   
8 (S)  agccagggagaggacccttg  60°C 
8 (AS)  gggaaggagatggggcaaatag   
9 (S)  aaggatttctgttgagacact  50°C 
9 (AS)  agcaagtcaacatatataccca   
10 (S)  cccagggaggtgcagtataa  56°C 
10 (AS)  gcgtttctcacgtacaaatgc   

(S): sense; (AS): antisense.

Three polymorphisms were identified by sequencing (361A>T, 380C>T and 383G>A) compatible with the RHCE*cE.15.02/RHCE*ce genotype (Figure 1). The RHCE*cE.15.02 allele is a rare variant, leading to a weakened expression of the E antigen.

Figure 1.
(0.15MB).

Result of the RHCE gene sequencing, with three polymorphisms compatible with the RHCE*cE.15.02/RHCE*ce genotype.

Discussion

In the present case, although the patient was genotyped as RHCE*E/RHCE*e, his respective phenotype was defined as E+ (weak positive) and E negative in the first and the second phenotyping tests, respectively. This discrepancy was due to the presence of three polymorphisms (361A>T, 380C>T and 383G>A) identified in the RHCE gene sequencing, responsible for the Ew antigen. A different molecular basis had already been identified: 500T>A; Met167Lys.6,9 As already cited, there is a report of anti-E alloimmunization in a Ew positive patient after receiving E positive erythrocytes.6 It is thus advisable to transfuse only E negative RBCs in these individuals.

Our results clearly reinforce the importance of erythrocyte phenotyping and genotyping as complementary tests in the transfusion routine of multi-transfused patients or candidates for chronic transfusions of RBCs, as in some cases, the detection of a certain allele by one molecular technique does not necessarily mean its complete or partial expression. In these situations, DNA sequencing is paramount, including in other cases where RBC phenotype and genotype discrepancies cannot be solved by molecular methodologies currently used in the routine and the patient has no history of recent transfusions.

Lastly, it is important to highlight the singularity of this case, considering that the phenotype has been detected in about 1:1000 Caucasians, with no reports in other ethnicities; however, here it was identified in a patient with sickle cell disease, which originates from the Black population. As the patient was mixed and reported that his parents and grandparents had the same ethnicity, this shows the high level of miscegenation of the Brazilian population.

Conflicts of interest

The authors declare no conflicts of interest.

Acknowledgements

To Emília Ângela Sippert, PhD, for performing the BeadChip technique and RHCE gene sequencing at the Laboratório de Biologia Molecular de Grupos Sanguíneos da Universidade Estadual de Campinas (UNICAMP).

References
[1]
W.A. Flegel
The genetics of the Rhesus blood group system
Blood Transfusion, 5 (2007), pp. 50-57 http://dx.doi.org/10.2450/2007.0011-07
[2]
L. Castilho,J. Pellegrino Junior,M.E. Reid
Fundamentos de Imuno-hematologia
1st ed., Atheneu, (2015)pp. 2
[3]
L. Castilho
Sistema de grupo sanguíneo Rh
Hemoterapia: Fundamentos e Prática, pp. 138-144
[4]
I. Mouro,Y. Colin,B. Chérif-Zahar,J.-P. Cartron,C. Le Van Kim
Molecular genetic basis of the human Rhesus blood group system
Nat Genet, 5 (1993), pp. 62-65 http://dx.doi.org/10.1038/ng0993-62
[5]
T.J. Greenwalt,R. Sanger
The Rh antigen Ew
Br J Haematol, 1 (1955), pp. 52-54
[6]
E. Strobel,F. Noizat-Pirenne,S. Hofmann,J.P. Cartron,M.F. Bauer
The molecular basis of the Rhesus antigen Ew
Transfusion, 44 (2004), pp. 407-409
[7]
R.K. Grobel,J.D. Cardy
Hemolytic disease of the newborn due to anti-Ew. A fourth example of the Rh antigen, Ew
Transfusion, 11 (1971), pp. 77-78
[8]
P. Bugert,E.A. Scharberg,C. Geisen,I. Von Zabern,W.A. Flegel
RhCE protein variants in Southwestern Germany detected by serologic routine testing
[9]
F. Noizat-Pirenne,I. Mouro,P. Gane,Y. Okubo,Y. Hori,P. Rouger
Heterogeneity of blood group RhE variants revealed by serological analysis and molecular alteration of the RHCE gene and transcript
Br J Haematol, 103 (1998), pp. 429-436
[10]
L. Castilho,M. Rios,C. Bianco,J. Pellegrino Junior,F.L. Alberto,S.T. Saad,F.F. Costa
DNA-based typing of blood groups for the management of multiply-transfused sickle cell disease patients
Transfusion, 42 (2002), pp. 232-238
Copyright © 2018. Associação Brasileira de Hematologia, Hemoterapia e Terapia Celular
Idiomas
Hematology, Transfusion and Cell Therapy

Subscribe to our Newsletter

Article options
Tools
en pt
Cookies policy Política de cookies
To improve our services and products, we use "cookies" (own or third parties authorized) to show advertising related to client preferences through the analyses of navigation customer behavior. Continuing navigation will be considered as acceptance of this use. You can change the settings or obtain more information by clicking here. Utilizamos cookies próprios e de terceiros para melhorar nossos serviços e mostrar publicidade relacionada às suas preferências, analisando seus hábitos de navegação. Se continuar a navegar, consideramos que aceita o seu uso. Você pode alterar a configuração ou obter mais informações aqui.